|
Sino Biological
f2 F2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/f2/product/Sino Biological Average 93 stars, based on 1 article reviews
f2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
R&D Systems
thrombin Thrombin, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/thrombin/product/R&D Systems Average 93 stars, based on 1 article reviews
thrombin - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Enzyme Research Laboratories
coagulation factors factor ii ![]() Coagulation Factors Factor Ii, supplied by Enzyme Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/coagulation factors factor ii/product/Enzyme Research Laboratories Average 90 stars, based on 1 article reviews
coagulation factors factor ii - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Kringle Pharma Inc
coagulation factor ii, thrombin ![]() Coagulation Factor Ii, Thrombin, supplied by Kringle Pharma Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/coagulation factor ii, thrombin/product/Kringle Pharma Inc Average 90 stars, based on 1 article reviews
coagulation factor ii, thrombin - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cusabio
pig coagulation factor ii elisa kit ![]() Pig Coagulation Factor Ii Elisa Kit, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pig coagulation factor ii elisa kit/product/Cusabio Average 93 stars, based on 1 article reviews
pig coagulation factor ii elisa kit - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Sino Biological
f2 acaggagtgcatagtgagctcgatctgacccagac r2 ggtgcaactggatcccctttgacgaccacctcggt 1 4 function analysis ![]() F2 Acaggagtgcatagtgagctcgatctgacccagac R2 Ggtgcaactggatcccctttgacgaccacctcggt 1 4 Function Analysis, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/f2 acaggagtgcatagtgagctcgatctgacccagac r2 ggtgcaactggatcccctttgacgaccacctcggt 1 4 function analysis/product/Sino Biological Average 93 stars, based on 1 article reviews
f2 acaggagtgcatagtgagctcgatctgacccagac r2 ggtgcaactggatcccctttgacgaccacctcggt 1 4 function analysis - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Siemens Healthineers
coagulation factor ii, v, vii, viii, ix, x, xi, and xii deficient plasmas assay kits ![]() Coagulation Factor Ii, V, Vii, Viii, Ix, X, Xi, And Xii Deficient Plasmas Assay Kits, supplied by Siemens Healthineers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/coagulation factor ii, v, vii, viii, ix, x, xi, and xii deficient plasmas assay kits/product/Siemens Healthineers Average 90 stars, based on 1 article reviews
coagulation factor ii, v, vii, viii, ix, x, xi, and xii deficient plasmas assay kits - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sysmex Corporation
immunodepleted factor deficient samples of single coagulation factors ii, v, viii, ix, x, xi, and xii ![]() Immunodepleted Factor Deficient Samples Of Single Coagulation Factors Ii, V, Viii, Ix, X, Xi, And Xii, supplied by Sysmex Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/immunodepleted factor deficient samples of single coagulation factors ii, v, viii, ix, x, xi, and xii/product/Sysmex Corporation Average 90 stars, based on 1 article reviews
immunodepleted factor deficient samples of single coagulation factors ii, v, viii, ix, x, xi, and xii - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Journal: Journal of Lipid Research
Article Title: Circulating membrane aminophospholipids contribute to thrombotic risk in rheumatoid arthritis
doi: 10.1016/j.jlr.2025.100842
Figure Lengend Snippet: RA patients show higher coagulation markers and EV counts in plasma, and their EV can support increased in vitro thrombin generation. A and B: d -dimer levels are raised in RA patients. d -dimer levels were measured as described in section, using ELISA in plasma from RA patients (n = 21) and HC (n = 16), showing absolute levels (ng/ml) and frequency of raised levels (%) above clinical cutoff of 500 ng/ml shown. C: TAT complexes are increased in plasma from RA patients . TAT complexes were measured using ELISA in plasma from RA patients (n = 25) and HC (n = 19). D: EVs from RA patients generate more thrombin. The ability of EVs in 6 ml plasma to support coagulation reactions was assessed using the prothrombinase assay, as described in section, for HC (n = 24) and RA patients (n = 22). E and F RA patients have increased plasma EV counts but no increase in diameter. EV particles were counted, from HC (n = 24) and RA (n = 24) plasma, as described in section. G: Thrombin generation is increased in RA plasma because of increased EV levels. Prothrombinase assay, using 10 10 EV particles, was applied to plasma from HC (n = 24) and RA (n = 21). Data were analyzed using Mann-Whitney test (∗ P < 0.05, ∗∗ P < 0.001, ∗∗∗ P < 0.001). H: EV particle counts correlate with thrombin generation and TAT levels in RA. Spearman correlation was performed comparing EV particle counts with TAT complexes (n = 22) in RA plasma. I: Heatmap for external-facing PE and PS levels in RA and HC plasma. EV particles were isolated followed by biotinylation of externalized lipids, as described in section. Lipids were extracted from plasma from HC (n = 19) and RA patients (n = 21) as described in section and analyzed by LC-MS/MS. Externalized aPLs in EV are shown in a heatmap (log10, ng/ml). J: Total aPLs are increased in EVs from RA. Total (internal + external) individual aPLs in EVs were analyzed using LC-MS/MS and shown in a heatmap (log10, ng/ml). K and L: Externalized PS was barely detected in EVs from RA plasma and undetectable in HC, whereas external-facing PE was similar in both groups. Externalized PS and PE levels were determined (ng/ml) for HC (n = 19) and RA (n = 21), using LC-MS/MS as described in section. M and N: Total PS and PE levels are increased in EVs in RA. Total (external and internal) aPLs were quantified as described in section or HC (n = 19) and RA (n = 22) (ng/ml of plasma). O–Q : Externalized PE is decreased in EVs from RA patients following normalization of EV count. Total aPL concentrations were adjusted to EV counts (10 10 EV particles), for HC (n = 18) and RA (n = 21), along with externalized PE for HC (n = 19) and RA patients (n = 20) (ng/10 10 EV particles). Data were analyzed using the Mann-Whitney test (∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001).
Article Snippet: Twenty microliter platelets (4 × 10 6 cells), WBC (8 × 10 4 cells), or EVs (equivalent to 6 ml of plasma) were incubated with 20 μl
Techniques: Coagulation, Clinical Proteomics, In Vitro, Enzyme-linked Immunosorbent Assay, MANN-WHITNEY, Isolation, Liquid Chromatography with Mass Spectroscopy
Journal: Veterinary Research
Article Title: TRIM28 regulates the coagulation cascade inhibited by p72 of African swine fever virus
doi: 10.1186/s13567-024-01407-6
Figure Lengend Snippet: ASFV infection regulated coagulation and related factors in vivo . A Evolution of rectal temperature, B clinical score in animals (6 animals) IM infected with 10 2.5 HAD 50 of ASFV HLJ/18. C viremia, viremia values are expressed as copies/mL, sensitivity of virus detection: > 1000 copies/mL, and D mortality. Dpi: days post-infection. E Sketch of the coagulation activation process. F ASFV-positive serum samples from each pig at the indicated time points were collected for detection of F10 and G F10 activity. H ASFV-positive serum samples from each pig at the indicated time points were collected for detection of F2 and I D2D by ELISA. Statistical data were analysed by t test analysis of variance (* p < 0.05, ** p < 0.01, and *** p < 0.001). All the data are expressed as the mean ± SD.
Article Snippet: The pig coagulation F10 ELISA kit,
Techniques: Infection, Coagulation, In Vivo, Virus, Activation Assay, Activity Assay, Enzyme-linked Immunosorbent Assay
Journal: Veterinary Research
Article Title: TRIM28 regulates the coagulation cascade inhibited by p72 of African swine fever virus
doi: 10.1186/s13567-024-01407-6
Figure Lengend Snippet: ASFV-encoded proteins regulated F10 expression and activity . A Several encoded proteins expressed in the baculovirus expression system were added to Huh7 cells at the same concentration for 24 h prior to supernatant and cell lysate collection. The mixtures were detected for F10 activity. B Huh7 cells were transfected with plasmids expressing ASFV-encoded proteins, including pK205R, pE199L, pEP153R, p30, p54, and p72, and then, the cells and supernatants were collected for detection of F10 expression by western blotting, C and secretory F10 expression by ELISA. For all figures, the experiments were repeated at least three times with similar results. The data are presented as the mean ± SD from one single experiment. Statistical significance was determined by Student’s t test (* p < 0.05).
Article Snippet: The pig coagulation F10 ELISA kit,
Techniques: Expressing, Activity Assay, Concentration Assay, Transfection, Western Blot, Enzyme-linked Immunosorbent Assay
Journal: Veterinary Research
Article Title: TRIM28 regulates the coagulation cascade inhibited by p72 of African swine fever virus
doi: 10.1186/s13567-024-01407-6
Figure Lengend Snippet: Functional domain of p72 . A Schematic of truncated p72 expression. B Confocal microscopy of truncated proteins in Huh7 cells; the target proteins are stained red. DAPI was used to stain the sections blue. Bar, 20 μm. C Truncated plasmids containing amino acids 1–150, 151–422, and 423–646, D 151–450, E and 423–646 of p72 with an HA tag at the C-terminus were transfected (0.5, 1, or 2 μg) into Huh7 cells. At 24 h post-transfection, the cell lysate was collected and subjected to western blot analysis, and the F cell supernatant was collected for detection of secretory F10 expression via ELISA. G Mutant plasmid construction schematic. The sequences of the six p72 mutants ranged from 423–450 aa, and every 10 amino acids were randomly mutated to alanine, which were named 101, 102 (423–432 aa), 201, 202 (433–442 aa), 301, and 302 (443–452 aa). H Confocal microscopy of mutant proteins in Huh7 cells. The target proteins are stained green. DAPI was used to stain the sections blue. Bar, 20 μm. I The mutant plasmids were transfected into Huh7 cells at increasing doses (0.5, 1, and 2 μg) . At 24 h post-transfection, the cells were lysed with lysis buffer, and 15 μg of each sample was subjected to western blotting. The band intensities were normalized to those of GAPDH via ImageJ software. The data are expressed as the mean intensity ratio ± SD of F10 to GAPDH. The experiment was performed in triplicate, and images from three independent experiments were plotted. J The cell supernatant was also collected for detection of secretory F10 expression via ELISA. Statistical data were analysed by t test variance (* p < 0.05, ns represents nonsignificant p > 0.05).
Article Snippet: The pig coagulation F10 ELISA kit,
Techniques: Functional Assay, Expressing, Confocal Microscopy, Staining, Transfection, Western Blot, Enzyme-linked Immunosorbent Assay, Mutagenesis, Plasmid Preparation, Lysis, Software
Journal: Heliyon
Article Title: Atrase A, a P-III class metalloproteinase purified from cobra venom, exhibits potent anticoagulant activity by inhibiting coagulation pathway and activating the fibrinolytic system
doi: 10.1016/j.heliyon.2024.e30969
Figure Lengend Snippet: Assay for incubation mixture of atrase A and coagulation factor A, B, C, D, E, F, and G represent coagulation factors II, V, X, IX, XI, XII, and VIII, respectively, with each coagulation factor at a concentration of 2 μg. The enzyme-to-substrate ratios used were as follows: 1:5, 1:3, 1:2, 1:2, 1:1, 1:2, 1:2, and 1:2. The separating gel concentrations used for (B) and (G) were 5 %, while the remaining concentrations were 10 %. (H) represents the Western blot result of atrase A cleavage with factor VIII at a ratio of 1:5. Original images are visible in the supplementary materials.
Article Snippet: Protein purification was performed with gels acquired from GE HealthCare Technologies, Inc. Standard human plasma and coagulation factor II, V, VII,
Techniques: Incubation, Coagulation, Concentration Assay, Western Blot
Journal: Heliyon
Article Title: Atrase A, a P-III class metalloproteinase purified from cobra venom, exhibits potent anticoagulant activity by inhibiting coagulation pathway and activating the fibrinolytic system
doi: 10.1016/j.heliyon.2024.e30969
Figure Lengend Snippet: The degree of recovery of coagulation function by adding coagulation factors In vitro, the final concentration of atrase A was 100 μg/mL, while in vivo, plasma was treated with atrase A at a dose of 0.3 mg/kg through tail vein injection for 1 h. In (A) each coagulation factor was added to the atrase A-treated plasma for APTT detection. Specifically, factor II was added at 10 μg, factor V at 1.32 μg, factor VIII at 3.13 IU, factor IX at 0.51 μg, and factor X at 1 μg. In (B), a combination of coagulation factors was added to the atrase A-treated plasma for APTT, with the following quantities: factor II at 10 μg, factor V at 1.32 μg, factor VIII at 0.042 IU or 0.021 IU, factor IX at 0.51 μg, and factor X at 0.033 μg or 0.067 μg. The summarized results are as follows.
Article Snippet: Protein purification was performed with gels acquired from GE HealthCare Technologies, Inc. Standard human plasma and coagulation factor II, V, VII,
Techniques: Coagulation, In Vitro, Concentration Assay, In Vivo, Clinical Proteomics, Injection